View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5067_low_29 (Length: 237)
Name: NF5067_low_29
Description: NF5067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5067_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 10923181 - 10922977
Alignment:
| Q |
16 |
aagaagatttggaagaaatgatgaatgatgatgaggaggaaaatgaatttgagttatctgatatggttgtaacagatgatttctttgaaggtttagatga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10923181 |
aagaagatttggaagaaatgatgaatgatgatgaggaggaaaatgaatttgagttatctgatatggttgtaacagatgatttctttgaaggtttagatga |
10923082 |
T |
 |
| Q |
116 |
attgacaggttttgctggagaaacagtagcatcatctggtggtgactgttttggtgacccttttgctgctagtattgctcttcctgcttgtggtggccaa |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10923081 |
attgacaggttttgctggaaaaacagtagcatcatctggtggtgactgttttggtgacccttttgctgctagtattgctcttcctgcttgtggtggccaa |
10922982 |
T |
 |
| Q |
216 |
tgatg |
220 |
Q |
| |
|
||||| |
|
|
| T |
10922981 |
tgatg |
10922977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University