View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5068-Insertion-4 (Length: 656)
Name: NF5068-Insertion-4
Description: NF5068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5068-Insertion-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 3e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 3e-90
Query Start/End: Original strand, 284 - 655
Target Start/End: Original strand, 24073117 - 24073476
Alignment:
| Q |
284 |
ctgaaggatatctactcatttatgagtagtctttctcnnnnnnnnncttcatttcgtacatgtttgtttcacatccaaatcccagctaacgtgcgtccat |
383 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||| ||||| || |
|
|
| T |
24073117 |
ctgagggatatctactcatttatgagtagtctttctcatttttttt-ttcatttcgtacatgtttgtttcacgtccaaatccgagctaacatgcgtttat |
24073215 |
T |
|
| Q |
384 |
tgtaaagctacattttgtagcttccttgttttcaccgcaaaattgcctagggacatgagatttgggnnnnnnnaacgcagtttcaaacaaccaccgcacc |
483 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
24073216 |
tgtaaagttacattttgtagctt----gttttcaccgcaaaattgcctaaggacatgagatttagattttttta-cgcagtttcaaacaaccaccgcac- |
24073309 |
T |
|
| Q |
484 |
gcaaatttcaaatgcaaccaaaacatgtttccgtagaaatgggcagggcttgctcataaatagtggatggttatgtttcttcattttgcccccatcctcc |
583 |
Q |
| |
|
||||||||||||||| |||||| ||||| |||||||||||| |||||||||| |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
24073310 |
----atttcaaatgcaacctaaacatttttccttagaaatgggcaaggcttgctcacaaatagtggatgattatgtttcttcattttttccccatcctcc |
24073405 |
T |
|
| Q |
584 |
tgctttgtttaggatgtactaat-taacatcgacattacatttatatgtgtgtgtttgtgtggttcccgtgtt |
655 |
Q |
| |
|
| |||||||||||||||||| || |||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
24073406 |
tactttgtttaggatgtactcatctaacatcgacattacatttata--tgtgtgttggtgtggttcccgtgtt |
24073476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 390 - 427
Target Start/End: Original strand, 42883922 - 42883959
Alignment:
| Q |
390 |
gctacattttgtagcttccttgttttcaccgcaaaatt |
427 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
42883922 |
gctacattttgtagcttccttattttcacggcaaaatt |
42883959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 390 - 443
Target Start/End: Original strand, 12294769 - 12294822
Alignment:
| Q |
390 |
gctacattttgtagcttccttgttttcaccgcaaaattgcctagggacatgaga |
443 |
Q |
| |
|
||||||||||||||||| || ||||||| |||||||||||||||||| ||||| |
|
|
| T |
12294769 |
gctacattttgtagctttgttattttcacggcaaaattgcctagggacgtgaga |
12294822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University