View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5068_low_3 (Length: 229)
Name: NF5068_low_3
Description: NF5068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5068_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 8037596 - 8037474
Alignment:
| Q |
1 |
catcatctccctctcatcttcaacttccttgtaaatttttattgagtccctcataagcttctcaatcttagttttgtcttctcctatttgtttggccaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8037596 |
catcatctccctctcatcttcaacttccttgtaaatttttattgagtccctcataagcttctcaatcttagttttgtcttctcctatttgtttggtcaat |
8037497 |
T |
 |
| Q |
101 |
tcatgacacacttcctctgttag |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8037496 |
tcatgacacacttcctctgttag |
8037474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 158 - 229
Target Start/End: Complemental strand, 8037439 - 8037368
Alignment:
| Q |
158 |
ataaactgcgcagtggattcgttacctacatccaattcatgcaacaatttggtattcagcaactccatcctc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8037439 |
ataaactgcgcagtggattcgttacctacatccaattcatgcaacaatttggtattcagcaactccatcctc |
8037368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University