View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5068_low_5 (Length: 227)
Name: NF5068_low_5
Description: NF5068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5068_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 8037886 - 8038094
Alignment:
| Q |
1 |
aatattctcgctcctctaatcaagtaacttcgtgctgcaacgatgaaacaatgatttctcacacgaaacagtctcaacatagaatggaaaacaacatgat |
100 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
8037886 |
aatattctcccgcctctaatcaagtagcttcgtgccgcaacgatgaaacaatgatttctcacacgaaatattctcaacatagaatggaaaacaacatgat |
8037985 |
T |
|
| Q |
101 |
tggcgaaactactacttctttatgtaaagattattctgttgaaggtagcttcaaacactttgaattattgaaacaaggaaactcaacagatcacaacatc |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8037986 |
tggtgaaactactacttctttatgtaaagattactctgttgaaggtagcttcaaacactttgaattattgaaacaagcaaactcaacagatcacaacatc |
8038085 |
T |
|
| Q |
201 |
aatcctcac |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
8038086 |
aatcctcac |
8038094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University