View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5070_high_12 (Length: 259)

Name: NF5070_high_12
Description: NF5070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5070_high_12
NF5070_high_12
[»] chr2 (1 HSPs)
chr2 (17-250)||(55700-55933)


Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 250
Target Start/End: Original strand, 55700 - 55933
Alignment:
17 actacaacgatgagaaaaatgtaaggaattgactgaagtgatgctggagggatatgaaatgattttgtgacatgtgtgtccatggcacttccttgctgga 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55700 actacaacgatgagaaaaatgtaaggaattgactgaagtgatgctggagggatatgaaatgattttgtgacatgtgtgtccatggcacttccttgctgga 55799  T
117 ccgagaatgtttgaagttgtgctaagatagtgttgaaaattatagtgcatgcaaaaattggaataaccgaaagtaatatctttgcttgttcaacttgtgc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55800 ccgagaatgtttgaagttgtgctaagatagtgttgaaaattatagtgcatgcaaaaattggaataaccgaaagtaatatctttgcttgttcaacttgtgc 55899  T
217 aacactacacaatctccacgggctttcctctgtg 250  Q
    ||||||||||||||||||||||||||||| ||||    
55900 aacactacacaatctccacgggctttcctttgtg 55933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University