View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5070_high_16 (Length: 206)

Name: NF5070_high_16
Description: NF5070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5070_high_16
NF5070_high_16
[»] chr5 (1 HSPs)
chr5 (16-191)||(22073616-22073791)


Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 16 - 191
Target Start/End: Original strand, 22073616 - 22073791
Alignment:
16 agatgaagattcggcatgacctgttaatggcacatgtaacttgttattttgaataattatatttcttttttctctgcttagaaccgcgacctctggttgg 115  Q
    |||||||||||| |||||||||||||||||||||| ||||||||||||||| | |||| | ||||||||||||||||||||||| |||||||||||||||    
22073616 agatgaagattcagcatgacctgttaatggcacatctaacttgttattttgcaaaattctttttcttttttctctgcttagaactgcgacctctggttgg 22073715  T
116 attctgcttccatcaaattgttttggattgggcagttgaggagaatgaacacaaacttttttggatgcagcaagtg 191  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
22073716 attctgcttccattaaattgttttggattgggcagttgaggagaatgaacacaaactttttttgatgcagcaagtg 22073791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University