View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5070_low_14 (Length: 246)
Name: NF5070_low_14
Description: NF5070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5070_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 13715821 - 13715583
Alignment:
| Q |
1 |
cctcaaaatgactgtttgcattggcttcactctatggatggggatttgtccaacaagttagcttatgattttctgaatacgaatcaagttgagttggtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715821 |
cctcaaaatgactgtttgcattggcttcactctatggatggggatttgtctaacaagttagcttatgattttctgaatacgaatcaagttgagttggtgc |
13715722 |
T |
 |
| Q |
101 |
aagtttatttgaaatgcctttgtccccaccccccacatnnnnnnnnnnnnnnnntcgggccttcatttgtttggagattggctcatcataagcttctaac |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
13715721 |
aagtttatttggaatgcctttgtccccaccccccacat--acacacacacacactcgggccttcatttgtttaaagattggctcatcaaaagcttctaac |
13715624 |
T |
 |
| Q |
201 |
taatgaccagttacgaataagagggtgtattttggtctctg |
241 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715623 |
tgatgaccagttacgaataagagggtgtattttggtctctg |
13715583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University