View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5070_low_15 (Length: 238)
Name: NF5070_low_15
Description: NF5070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5070_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 54293022 - 54293230
Alignment:
| Q |
13 |
caaaggtgaagaggaagaatcaacgagttaaaggatgagggaataagagctgcaaaagtcattgtataacttgcaggatttgacagcatagatgtaaaga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54293022 |
caaaggtgaagaggaagaatcaacgagttaaaggatgagggaataagagctgcaaaagtcattgtatgacttgcaggatttgacagcatagatgtaaaga |
54293121 |
T |
 |
| Q |
113 |
aacatcaatactactctgcagaacctgacagcacaaaggcaaagggaaaactacacactactttgcggaatttgagattgataaaaaatctgtacagtag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54293122 |
aacatcaatactactctgcagaacctgacagcacaaaggcaaagggaaaactacacactactttgcggaatttgagattgataaaaaatctgtacagtag |
54293221 |
T |
 |
| Q |
213 |
tactattag |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
54293222 |
tactattag |
54293230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University