View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5070_low_17 (Length: 206)
Name: NF5070_low_17
Description: NF5070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5070_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 16 - 191
Target Start/End: Original strand, 22073616 - 22073791
Alignment:
| Q |
16 |
agatgaagattcggcatgacctgttaatggcacatgtaacttgttattttgaataattatatttcttttttctctgcttagaaccgcgacctctggttgg |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||| | |||| | ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22073616 |
agatgaagattcagcatgacctgttaatggcacatctaacttgttattttgcaaaattctttttcttttttctctgcttagaactgcgacctctggttgg |
22073715 |
T |
 |
| Q |
116 |
attctgcttccatcaaattgttttggattgggcagttgaggagaatgaacacaaacttttttggatgcagcaagtg |
191 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22073716 |
attctgcttccattaaattgttttggattgggcagttgaggagaatgaacacaaactttttttgatgcagcaagtg |
22073791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University