View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071-Insertion-15 (Length: 114)
Name: NF5071-Insertion-15
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071-Insertion-15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 33; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 51 - 83
Target Start/End: Complemental strand, 32811750 - 32811718
Alignment:
| Q |
51 |
cataatctttatggttcgtgtttagctttctca |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32811750 |
cataatctttatggttcgtgtttagctttctca |
32811718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University