View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071-Insertion-18 (Length: 185)
Name: NF5071-Insertion-18
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071-Insertion-18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 3e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 7 - 154
Target Start/End: Original strand, 27729688 - 27729835
Alignment:
| Q |
7 |
agggataatgtggtggctactttgcatggagatattatagctgcaacgaggtgcttgatggcatcaaacaagaatcagggcattgtctccctgccaaaga |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27729688 |
agggttaatgtggtggctactttgcatggagatattatagctgcaacgaggtgcttcatggcatcaaacaagaatcagggcattgtcttcctgccaaaga |
27729787 |
T |
 |
| Q |
107 |
ctccaacaaaataggaagaaaaaggaaagacaaaaatactcttaattc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27729788 |
ctccaacaaaataggaagaaaaaggaaagacaaaaatactcttaattc |
27729835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University