View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071-Insertion-9 (Length: 176)
Name: NF5071-Insertion-9
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071-Insertion-9 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 9 - 176
Target Start/End: Original strand, 6729797 - 6729964
Alignment:
| Q |
9 |
tatatataattaaatctgacttatatgtactatgatgctgtcatatactgaggaataaagcttattatatagagagatataagaattcatttgtgagtgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6729797 |
tatatataattaaatctgacttatatgtactatgatgctgtcatatactgaggaataaagcttattatatagagagatataagaattcatttgtgtgtgc |
6729896 |
T |
|
| Q |
109 |
atggcatgcagatgcagatttatatgtgcagtgtatatgtattatgtactcactctttcattgactcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6729897 |
atggcatgcagatgcagatttatatgtgcagtgtatatgtattatgtaatcactctttcattgactcc |
6729964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University