View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071_high_22 (Length: 267)
Name: NF5071_high_22
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 19353864 - 19353613
Alignment:
| Q |
1 |
ccaaaaggtattcgttgcttgatcatataatattataaaaaagaataaaataaatagattcgttccttaatgatgttattnnnnnnngagattcttctta |
100 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
19353864 |
ccaaaaggtattctttccttgatcatataatattataaaaaagaataaaataaatagattcgttccttaatgatattattaaaaaaagagattcttctta |
19353765 |
T |
|
| Q |
101 |
gtttgcagttaaagttgctttcattttcagctcattataaattgcaaagttctccgtttgtgaaatacataaaaaagagtgctgtgtaatttttgcaatt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19353764 |
gtttgcagttaaagttgctttctttttcaggtcattataaattgcaaggttctccgtttgtgaaatacataaaaaagagtgctgtgtaatttttgcaatt |
19353665 |
T |
|
| Q |
201 |
tgtatttgagtcctcaactttcatatttcccttttacattccttgtcctcgt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19353664 |
tgtatttgagtcctcaactttcatatttcccttttacattccttgtcctcgt |
19353613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University