View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071_high_40 (Length: 234)
Name: NF5071_high_40
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071_high_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 61 - 221
Target Start/End: Original strand, 6486678 - 6486838
Alignment:
| Q |
61 |
ggagagaccttccagggtcgtagtagtaagggctcatgggggaggcggcgctgctgctacgcatggcatagtcatcgtcagtataggcttctgttgtgga |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486678 |
ggagagaccttccagggtcgtagtagtaagggctcatgggggaggcggcgctgctgctacgcatggcatagtcatcgtcagtataggcttctgttgtgga |
6486777 |
T |
|
| Q |
161 |
aaatcggggttcggattgcataaactgtggacgaggaatgttattattgttgttgctgctg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6486778 |
aaatcggggttcggattgcataaactgtggacgaggaatgttattgttgttgttgctgctg |
6486838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University