View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071_high_45 (Length: 216)
Name: NF5071_high_45
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071_high_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 41277171 - 41276985
Alignment:
| Q |
13 |
ataatactctgaactagatgatgaataatggaatcagttacatccatcgctaacaatatatcattgtccaactctcagttataggtgctgctgctcttct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277171 |
ataatactctgaactagatgatgaataatggaatcagttacatccatcgctaacaatatatcattgtccaactctcagttataggtgctgctgctcttct |
41277072 |
T |
 |
| Q |
113 |
gccaaccaaaataaatatacatcaaatgaccttgtttgtatactcatgtcttcgtgtgtggaccagcaaaatgagaattgttgttcc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277071 |
gccaaccaaaataaatatacatcaaatgaccttgtttgtatactcatgtcttcgtgtgtggaccagcaaaatgagaattgttgttcc |
41276985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University