View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071_high_7 (Length: 383)
Name: NF5071_high_7
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 26840948 - 26840733
Alignment:
| Q |
1 |
tgttttaagtcgaaaagaacatatatttgggtgcttttatttcttctctttatggtttctcatacaccattatggatcgactaaagaaaggtatagacat |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26840948 |
tgttttaagtcgaaaagaacatagctttgggttcttt-atttcttctctttatggtttcttatacaccattatggatcaactaaagaaaggtatagacat |
26840850 |
T |
 |
| Q |
101 |
aaaacacattagtggactcatttagttcctccaatttcggtggaaggtttgtttgtctcaaaggtgtggttatcctattgtcgacgtcgtagttagttgt |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
26840849 |
aaagcacattagtggactcatttagttcctccaatttcggtggaaggttcgtttgtctcaaaggtgtggttgtcctattgtcaacgtcgtagttagttgt |
26840750 |
T |
 |
| Q |
201 |
tttttgtgggcgtgtgt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
26840749 |
tttttgtgggcgtgtgt |
26840733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 252 - 375
Target Start/End: Complemental strand, 26840189 - 26840066
Alignment:
| Q |
252 |
gagttttattgtatggttgggattcggatacgcaagggtaagtagagacctctctcccgccaccgaaccaactatccttcctgcacgaaggatgagaata |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26840189 |
gagttttattgtatggttgggattcggatacgcaagggtcagtagagacctctctcccgccaccgaaccaactatccttcctgcacgaaggatgagaata |
26840090 |
T |
 |
| Q |
352 |
atgaaccccttctctatctctgct |
375 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
26840089 |
atgaaccccttctctatctctgct |
26840066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University