View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071_high_8 (Length: 376)
Name: NF5071_high_8
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 3497679 - 3497428
Alignment:
| Q |
18 |
atctccgcattctctcatggacgaagatttcgatattcctgcggttgattctatgaacgacgatttcgacttcgccggcgccggcgataatccaattctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3497679 |
atctccgcattctctcatggacgaagatttcgatattcctgcggttgattctatgaacgacgatttcgacttcgccggcgccggcgataatccaattctc |
3497580 |
T |
|
| Q |
118 |
aaggtcggtgaggaaaaggaaatcggaaagcaaggtttgaagaagaagcttctcaaagaaggtgaaggttgggatactcctgatgttggcgatgaagttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3497579 |
aaggtcggtgaggaaaaggaaatcggaaagcaaggtttgaagaagaagcttctcaaagaaggtgaaggttgggatactcctgatgttggcgatgaagttc |
3497480 |
T |
|
| Q |
218 |
acggtactgaattggaattgattgaattttatctctctttgttcattcttcg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3497479 |
acggtactgaattggaattgattgaattttatctctctttgttcattcttcg |
3497428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 325 - 376
Target Start/End: Complemental strand, 3497372 - 3497321
Alignment:
| Q |
325 |
taatgtgtagttcattatactggaacgttgcttgatggtacgaagtttgatt |
376 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3497372 |
taatgtgtagttcattataccggaacgttgcttgatggtacgaagtttgatt |
3497321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 201
Target Start/End: Complemental strand, 34977408 - 34977358
Alignment:
| Q |
151 |
ggtttgaagaagaagcttctcaaagaaggtgaaggttgggatactcctgat |
201 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||| ||||| ||||||||| |
|
|
| T |
34977408 |
ggtttgaagaagaagcttgttaaggaaggtgaagggtgggaaactcctgat |
34977358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 327 - 374
Target Start/End: Complemental strand, 14391121 - 14391071
Alignment:
| Q |
327 |
atgtgtagttcattatactggaac---gttgcttgatggtacgaagtttga |
374 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
14391121 |
atgtgtagttcattttactggaacgttgttgcttgatggtaagaagtttga |
14391071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 18850769 - 18850726
Alignment:
| Q |
157 |
aagaagaagcttctcaaagaaggtgaaggttgggatactcctga |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18850769 |
aagaagaagcttctcaaacttggtgaaggttgggatactcctga |
18850726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University