View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071_low_13 (Length: 350)
Name: NF5071_low_13
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 9 - 331
Target Start/End: Complemental strand, 18074730 - 18074408
Alignment:
| Q |
9 |
acatcatcattatcaaacgttgcaataggaggcataatcaatcacaacccacaaggccaaatcttatggttattgaaggatttgaaagaagctttgaaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18074730 |
acatcatcattatcaaacgttgcaataggaggcataatcaatcacaacccacaaggccaaatcttatggttattgaaggatttgaaagaagctttgaaaa |
18074631 |
T |
 |
| Q |
109 |
ccaacaaaggaacttgctttcaagcttcaagtacaagaaggaagtggtagcaaaagaacaagagcataagggttatgattatgaatgctatgtttgctta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18074630 |
ccaacaaaggaacttgctttcaagcttcaagtacaagaaggaagtggtagcaaaagaacaagaacataagggttatgattatgaatgctatgtttgctta |
18074531 |
T |
 |
| Q |
209 |
tcggtttatgaagaaggggaagatgttaggaagctaccaaagtgtaaacattgttttcatgctctttgtatagatatgtggctttattctcactttgatt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18074530 |
tcggtttatgaagaaggggaagatgttaggaagctaccaaagtgtaaacattgttttcatgctctttgtatagatatgtggctttattctcactttgatt |
18074431 |
T |
 |
| Q |
309 |
gcccaatttgtagaacacctgtt |
331 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
18074430 |
gcccaatttgtagaacacctgtt |
18074408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University