View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071_low_16 (Length: 337)
Name: NF5071_low_16
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 327
Target Start/End: Complemental strand, 11354103 - 11353799
Alignment:
| Q |
19 |
tttttgccttgacagttatttttcagcaaactgaacaaacatgtaactgcagtgtgcacattgcacaaaacttattgccagatcaacttctgtattgcat |
118 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||||||| ||||| |||| |||||| ||| |||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
11354103 |
tttttcccttgacagttctttttcagcaagctgaacagacatgcaactacagtgtctaca----acaacactcattgccagatcaacttctgtattgcat |
11354008 |
T |
|
| Q |
119 |
ctagctttctcccaaacagcctccatgtgagctcgatttctggcagacaagaggtcatgggacacctttataatgcaatctttctcatgttggggcagac |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11354007 |
ccagctttctcccaaacagcctccatgtgagctcgatttctggcagacaagaggtcatgggacacctttataatacaatctttctcatgttggggcagac |
11353908 |
T |
|
| Q |
219 |
acccaagccaaccttgaaacaaacaacttgcatttttgcagaatttatagtccccacagcttagtccactcactcaccttgtgcacccttaattttcttg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
11353907 |
acccaagccaaccttgaaacaaacaacttgcatttttgcagaatttatagtccccacagattagtccactcactcgccttgtgcacccttaattttcgtg |
11353808 |
T |
|
| Q |
319 |
atgtttcat |
327 |
Q |
| |
|
||||||||| |
|
|
| T |
11353807 |
atgtttcat |
11353799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University