View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071_low_18 (Length: 327)
Name: NF5071_low_18
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 9e-61; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 191 - 317
Target Start/End: Complemental strand, 43803180 - 43803054
Alignment:
| Q |
191 |
acttttgaatttctaatccattattgttagcatatattatgaacaaaagaaacaaatagaaaaagtgattctcattactcaattatggaaagtacaagat |
290 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43803180 |
acttttggatttctaatccattattgttagcatatattatgaacaaaagaaacaaatagaaaaagtgattctcattactcaattatggaaagtacaagat |
43803081 |
T |
 |
| Q |
291 |
gtatatatacatgaattgtgacctatg |
317 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
43803080 |
gtatatatacatgaattgtgatctatg |
43803054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 139 - 204
Target Start/End: Complemental strand, 43803268 - 43803203
Alignment:
| Q |
139 |
tctaaggtggttcaaataaccctattattgttttttatagatactgtacaacacttttgaatttct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43803268 |
tctaaggtggttcaaataaccctattattgttttttatagatactgtacaacacttttgaatttct |
43803203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 17 - 50
Target Start/End: Complemental strand, 43803390 - 43803357
Alignment:
| Q |
17 |
atttagtgctgtaagtattcactatttccatggc |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43803390 |
atttagtgctgtaagtattcactatttccatggc |
43803357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University