View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071_low_30 (Length: 247)
Name: NF5071_low_30
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071_low_30 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 11 - 247
Target Start/End: Original strand, 3496846 - 3497092
Alignment:
| Q |
11 |
cacagacaccgaacacaacactaacacagacagtggcaaaaaattaattaattgaatgcaatc--atgtgttggcactgacacatgtcaatcatgtgcca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | | |
|
|
| T |
3496846 |
cacagacaccgaacacaacactaacacatacagtggcaaaaaattaattaattgaatgcaatcatatgtgttggcactgacacatgtcaatcatgttcaa |
3496945 |
T |
|
| Q |
109 |
cgcttacatcaaaagtgtcactactgcaaatctta---------tataagccgttttcaactcatttcaatacattccatatgataactcatcaaaacag |
199 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
3496946 |
cggttacaacaaaagtgtcactactgcaaatcttatgacatgtctataagccgttttcacctcgtttcagtacattccatatga-gactcatcaaaacag |
3497044 |
T |
|
| Q |
200 |
ctcccaattttatgaaaacatttagctacattccctgctacattatat |
247 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3497045 |
ctcccaattttatgaaaacatttaactacattccctgctacattatat |
3497092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University