View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5071_low_42 (Length: 236)
Name: NF5071_low_42
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5071_low_42 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 6745510 - 6745279
Alignment:
| Q |
1 |
ctaatttgatgcagactaggtcatgtacccctaaaagtggtttggcctatttctatcattagatgaaattttttggctgatttacaaaatgagttaagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
6745510 |
ctaatttgatgcagactaggtcatgtacccctaaaagtggtttggcctatttctatcattagatgaaattttt-ggct---ttacaaaatgagttaagat |
6745415 |
T |
 |
| Q |
101 |
aaatgatttgatgtattgtttacaattttttcttactattttatttatatgattttagaaattatcatgtctgcatgttttgtagattgtaattataatt |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6745414 |
aaatgatttgatgtattttttacaattttttcttactattttatttatatgattttagaaattatcatgtctgcatgttttgtagattgtaattataatt |
6745315 |
T |
 |
| Q |
201 |
attacttattctttctttgttttccttgacataatt |
236 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6745314 |
attacttattctttctttgttatccttgacataatt |
6745279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University