View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5071_low_43 (Length: 234)

Name: NF5071_low_43
Description: NF5071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5071_low_43
NF5071_low_43
[»] chr1 (1 HSPs)
chr1 (61-221)||(6486678-6486838)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 61 - 221
Target Start/End: Original strand, 6486678 - 6486838
Alignment:
61 ggagagaccttccagggtcgtagtagtaagggctcatgggggaggcggcgctgctgctacgcatggcatagtcatcgtcagtataggcttctgttgtgga 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6486678 ggagagaccttccagggtcgtagtagtaagggctcatgggggaggcggcgctgctgctacgcatggcatagtcatcgtcagtataggcttctgttgtgga 6486777  T
161 aaatcggggttcggattgcataaactgtggacgaggaatgttattattgttgttgctgctg 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
6486778 aaatcggggttcggattgcataaactgtggacgaggaatgttattgttgttgttgctgctg 6486838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University