View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5072_high_5 (Length: 283)
Name: NF5072_high_5
Description: NF5072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5072_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 18 - 125
Target Start/End: Original strand, 34457331 - 34457438
Alignment:
| Q |
18 |
aaagggtgcagaaatccttgctcattttgttggcttcatggcttgtcaacaacacaatagtactggtaaccagacttggttttgtttttggttaataatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34457331 |
aaagggtgcagaaatccttgctcattttgttggcttcatggcttgtcaacaacacaatagtactggtaacaagacttggttttgtttttggttaataatt |
34457430 |
T |
 |
| Q |
118 |
cagacttg |
125 |
Q |
| |
|
||||||| |
|
|
| T |
34457431 |
tagacttg |
34457438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 81; Significance: 4e-38; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 18 - 125
Target Start/End: Complemental strand, 39872749 - 39872644
Alignment:
| Q |
18 |
aaagggtgcagaaatccttgctcattttgttggcttcatggcttgtcaacaacacaatagtactggtaaccagacttggttttgtttttggttaataatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39872749 |
aaagggtgcagaaatccttgctcattttgttggcttcccggcttgtcaacaacacaagagtactggt--tcagacttggttttgtttttggttaataatt |
39872652 |
T |
 |
| Q |
118 |
cagacttg |
125 |
Q |
| |
|
|||||||| |
|
|
| T |
39872651 |
cagacttg |
39872644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 153 - 228
Target Start/End: Complemental strand, 39872627 - 39872552
Alignment:
| Q |
153 |
tatgactgattttatttgtcttccggtcaaagaatttggttcgttcatgttatgtgactaatgattttattagtct |
228 |
Q |
| |
|
|||||||| ||||||||||||||| |||| | ||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
39872627 |
tatgactggttttatttgtcttccagtcacaaaatttggttcgttcatgttatgtgactgctgattttatcagtct |
39872552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 247 - 283
Target Start/End: Complemental strand, 39872555 - 39872519
Alignment:
| Q |
247 |
gtctcatatttaatgagataaagtctaaaatgatttt |
283 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
39872555 |
gtctcatatttgatgagataaagtctaaaattatttt |
39872519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University