View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5072_high_6 (Length: 283)
Name: NF5072_high_6
Description: NF5072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5072_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 197 - 261
Target Start/End: Complemental strand, 50762342 - 50762276
Alignment:
| Q |
197 |
tatccaaaaatacttacac--cggaaaaaacataatttagtctacttctgtgcactccaatacaaca |
261 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50762342 |
tatccaaaaatacttacacaccggaaaaaacataatttagtctacttctgtgcactccaatacaaca |
50762276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University