View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5072_high_8 (Length: 264)
Name: NF5072_high_8
Description: NF5072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5072_high_8 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 98 - 264
Target Start/End: Original strand, 50761981 - 50762147
Alignment:
| Q |
98 |
gtcccttctttgttgtactgctgcttcatttattatttattcatttccattttggattctcatcacctaccaacctctttccatttattattttatttgg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50761981 |
gtcccttctttgttgtactgctgcttcatttattatttattcatttccattttggattctcatcacctaccaacctctttccatttattattttatttgg |
50762080 |
T |
 |
| Q |
198 |
ttttgtcatgggattcaattcaatcatcgtgcaacacgaggacaccgtgggcacaaaacaattaaac |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50762081 |
ttttgtcatgggattcaattcaatcatcgtgcaacacgaggactccgtgggcacaaaacaattaaac |
50762147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 60 - 89
Target Start/End: Original strand, 50761930 - 50761959
Alignment:
| Q |
60 |
attgattaaattgaattgatctatattatt |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50761930 |
attgattaaattgaattgatctatattatt |
50761959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 21250864 - 21250920
Alignment:
| Q |
122 |
ttcatttattatttattcatttccattttggattctcatcacctaccaacctctttcc |
179 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
21250864 |
ttcatttattatttattcatttccatttt-cattctcatcacctacctacctctttcc |
21250920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 21251788 - 21251843
Alignment:
| Q |
122 |
ttcatttattatttattcatttccattttggattctcatcacctaccaacctctttcc |
179 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||| ||||||||||| |||||||||| |
|
|
| T |
21251788 |
ttcatttattatttattcatt-ccattt-ggattcacatcacctacctacctctttcc |
21251843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University