View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5072_low_17 (Length: 238)

Name: NF5072_low_17
Description: NF5072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5072_low_17
NF5072_low_17
[»] chr7 (1 HSPs)
chr7 (14-223)||(44345464-44345673)


Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 44345464 - 44345673
Alignment:
14 atatcttacaaaattaaagaagaacgggaagatgaaaggaagaaacagagttgcactttcagattgtatagaaacttttggctatgcacttgatgagctt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||    
44345464 atatcttacaaaattaaagaagaacgggaagatgaaaggaagaaacagagttgcactttcagactgtatagaaacttttggctatgcagttgatgagctt 44345563  T
114 cataagtcacttggtgtgcttaggaaattaagcaagaacacatttagtacacaaatgggggatctcaacacatggattagtgcagctcttactaatgaag 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44345564 cataagtcacttggtgtgcttaggaaattaagcaagaacacatttagtacacaaatgggggatctcaacacatggattagtgcagctcttactaatgaag 44345663  T
214 acacatgcct 223  Q
    ||||||||||    
44345664 acacatgcct 44345673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University