View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5072_low_17 (Length: 238)
Name: NF5072_low_17
Description: NF5072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5072_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 44345464 - 44345673
Alignment:
| Q |
14 |
atatcttacaaaattaaagaagaacgggaagatgaaaggaagaaacagagttgcactttcagattgtatagaaacttttggctatgcacttgatgagctt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44345464 |
atatcttacaaaattaaagaagaacgggaagatgaaaggaagaaacagagttgcactttcagactgtatagaaacttttggctatgcagttgatgagctt |
44345563 |
T |
 |
| Q |
114 |
cataagtcacttggtgtgcttaggaaattaagcaagaacacatttagtacacaaatgggggatctcaacacatggattagtgcagctcttactaatgaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44345564 |
cataagtcacttggtgtgcttaggaaattaagcaagaacacatttagtacacaaatgggggatctcaacacatggattagtgcagctcttactaatgaag |
44345663 |
T |
 |
| Q |
214 |
acacatgcct |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
44345664 |
acacatgcct |
44345673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University