View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5072_low_21 (Length: 224)

Name: NF5072_low_21
Description: NF5072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5072_low_21
NF5072_low_21
[»] chr3 (1 HSPs)
chr3 (19-208)||(39732031-39732220)


Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 39732220 - 39732031
Alignment:
19 aatagaatctgttacttttacaaagtggtaaacgtaattgagaggcagttgacaaaatcaaatgcaacaaaactaaacaaatgttggacccactccaaaa 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39732220 aatagaatctgttacttttacaaagtggtaaacgtaattgagaggcagttgacaaaatcaaatgcaacaaaactaaacaaatgttggacccactccaaaa 39732121  T
119 tcgtaaaagccatgtaaatgagctatcaacaaaaaacaagaatctataactttaannnnnnnagtccatttctttatcaccctctcattg 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||    
39732120 tcgtaaaagccatgtaaatgagctatcaacaaaaaacaagaatctataactttaatttttttagtccatttctttatcaccctctcattg 39732031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University