View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5072_low_9 (Length: 283)

Name: NF5072_low_9
Description: NF5072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5072_low_9
NF5072_low_9
[»] chr1 (1 HSPs)
chr1 (197-261)||(50762276-50762342)


Alignment Details
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 197 - 261
Target Start/End: Complemental strand, 50762342 - 50762276
Alignment:
197 tatccaaaaatacttacac--cggaaaaaacataatttagtctacttctgtgcactccaatacaaca 261  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||    
50762342 tatccaaaaatacttacacaccggaaaaaacataatttagtctacttctgtgcactccaatacaaca 50762276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University