View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5073-Insertion-10 (Length: 267)
Name: NF5073-Insertion-10
Description: NF5073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5073-Insertion-10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 71 - 183
Target Start/End: Original strand, 42155483 - 42155593
Alignment:
| Q |
71 |
caatatacaataaggggggagaagagtgaacccataagggagctaagatatcgagggggagatataagaaacaccatatcccctcaatcgagcacccaaa |
170 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42155483 |
caatatacaataaggggg-agaagagtgaacccataagggagctaagatatcgagggg-agatataagaaacaccatatccctccaatcgagcacccaaa |
42155580 |
T |
|
| Q |
171 |
aaatattcaagaa |
183 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42155581 |
aaatattcaagaa |
42155593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University