View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5073-Insertion-5 (Length: 376)
Name: NF5073-Insertion-5
Description: NF5073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5073-Insertion-5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 8 - 376
Target Start/End: Original strand, 44987292 - 44987660
Alignment:
| Q |
8 |
gcatggtctgtaattggtacaatgaatcttagagattcaatcacgtacacatgtttagccgcaaggctaaaccagaaggggcatcatggaatagcattaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44987292 |
gcatggtctgtaattggtacaatgaatcttagagattcaatcacgtacacatgtttagccgcaaggctaaaccagaaggggcatcatggaatggcattaa |
44987391 |
T |
|
| Q |
108 |
aagttttgattcacatgtgcaatgatgggattaaaatggatgaatttagcttggcaagtttcttatcagctgcagctggcttaggcactatggaaactgg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44987392 |
aagttttgattcacatgtgcaatgatgggattaaaatggatgaatttagcttggcaagtttcttatcagctgcagctggcttaggcactatggaaactgg |
44987491 |
T |
|
| Q |
208 |
aaagcagctgcattgttattctgtcaaatcaggcttccagagatgtcactcagtttcaaacagcttagttcacttgtacagcaaatgtggtagtattcac |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44987492 |
aaagcagctgcattgttattctgtcaaatcaggcttccagagatgtcactcagtttcaaacagcttagttcacttgtacagcaaatgtggtagtattcac |
44987591 |
T |
|
| Q |
308 |
gatgcaaatagagcttttaaagatattagtgagccagatgcattttcatggaacggtttgatatctgga |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44987592 |
gatgcaaatagagcttttaaagatattagtgagccagatgcattttcatggaacggtttgatatctgga |
44987660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University