View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5073_low_5 (Length: 329)
Name: NF5073_low_5
Description: NF5073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5073_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 19 - 322
Target Start/End: Original strand, 6705767 - 6706070
Alignment:
| Q |
19 |
caaatgcccagttatgtggtactagatgttgatgttgttgttgatgaccataggttggaccacttggcattgacatagatatggacaaggacgaagaaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6705767 |
caaatgcccagttatgtggtactagatgttgatgttgttgttgatgaccataggttggaccacttggcattgacatagatatggacaaggacgaagaaga |
6705866 |
T |
 |
| Q |
119 |
tgaggaagatgtcgtttgttcgaaaaacaaagaagaattaaaatttgagcaacctctggtcgatggttgctccaaattgggccgcgaagcagcccaattt |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6705867 |
tgaggaagatgtcgtttgttcaaaaaacaaagaagaattaaaatttgagcaacctctggtcgatggttgctccaaattgggccgcgaagcagcccaattt |
6705966 |
T |
 |
| Q |
219 |
gttggtaacaactcaagctccaacaagcctgaactgcttgttggagtctggttatgatcacgaccatgtttcgtggttgtggtcacggccgtattaccta |
318 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6705967 |
gttggtaacaactcaagctccagcaagcctgaactgcttgttggagtctggttatgatcacgaccatgtttcgtggttgtggtcacggccgtattaccta |
6706066 |
T |
 |
| Q |
319 |
tgct |
322 |
Q |
| |
|
|||| |
|
|
| T |
6706067 |
tgct |
6706070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University