View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5073_low_6 (Length: 275)
Name: NF5073_low_6
Description: NF5073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5073_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 5189659 - 5189400
Alignment:
| Q |
1 |
agtgacaattgactcaaaagctatacattattagaccaaaacacccccataaatatcgttatttacatgtagtacctcctaccatatgcctttaaatacg |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5189659 |
agtgacaactgactcaaaagctatacattattagaccaaaacacccccataaatatcattatttacatgtagtacctcctacaatatgcctttaaatacg |
5189560 |
T |
 |
| Q |
101 |
agccccttaagcagcgtttcttccctttctctttctttcctttcactactttttacttagcaataaccatgctctcttccctctattcctccgatttcac |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5189559 |
agtcccttaagcagcgtttcttccctttctccttctttcctttcactactttttacttagcaataaccatgctctcttccctctattcctccgatttcac |
5189460 |
T |
 |
| Q |
201 |
ggcgttagacgaaagtttaacgccgtgggatttttctaacattctgtcccccatccaacc |
260 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5189459 |
ggcgttagacaaaagtttaacgccgtgggatttttctaacattctgtcccccatccaacc |
5189400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University