View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5074-Insertion-2 (Length: 56)
Name: NF5074-Insertion-2
Description: NF5074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5074-Insertion-2 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 46; Significance: 4e-18; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 11 - 56
Target Start/End: Original strand, 11787829 - 11787874
Alignment:
| Q |
11 |
ccttccatcacattttgttctcctcagtcacaagttatcttattct |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11787829 |
ccttccatcacattttgttctcctcagtcacaagttatcttattct |
11787874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 11 - 56
Target Start/End: Original strand, 11799996 - 11800041
Alignment:
| Q |
11 |
ccttccatcacattttgttctcctcagtcacaagttatcttattct |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11799996 |
ccttccatcacattttgttctcctcagtcacaagttatcttattct |
11800041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 18 - 56
Target Start/End: Original strand, 11707526 - 11707564
Alignment:
| Q |
18 |
tcacattttgttctcctcagtcacaagttatcttattct |
56 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
11707526 |
tcacattttgttctcctcaatcacaagtaatcttattct |
11707564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University