View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5074_low_3 (Length: 255)
Name: NF5074_low_3
Description: NF5074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5074_low_3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 15 - 255
Target Start/End: Complemental strand, 50502519 - 50502279
Alignment:
| Q |
15 |
cacagaggaacacctgaaaaccctgcaagaacttgcactttggaggagaaagaaggggaaatttgcgtaagtttatatttgatttctgtgatgctttatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50502519 |
cacagaggaacacctgaaaaccctgcaagaacttgcactttggaggagaaagaaggggaaatttgcgtaagtttatatttgatttctgtgatgctttatc |
50502420 |
T |
|
| Q |
115 |
ttgtcttgaagtgattatttttatatttgatttcttactatcatttttgttttcagtggggagttgcttattgcgttcgaggaggccctgaaaaggaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50502419 |
ttgtcttgaagtgattatttttatatttgatttcttactatcatttttgttttcagtggggagttgcttattgcgttcgaggaggccctgaaaaggaaaa |
50502320 |
T |
|
| Q |
215 |
actggctatgcaggtaaaactattttttccctatacaattc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50502319 |
actggctatgcaggtaaaactattttttccctatacaattc |
50502279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University