View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076-Insertion-10 (Length: 188)
Name: NF5076-Insertion-10
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076-Insertion-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 8 - 188
Target Start/End: Complemental strand, 24694851 - 24694671
Alignment:
| Q |
8 |
aatttcatgcatatcatcaaaaagacatgaaataggggactaagaggctgaaactgatggaatgagataatggttttgatgcgaaagagcttcgtcctaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24694851 |
aatttcatgcatatcatcaaaaagacatgaaataggggactaagaggctgaaactgatggaatgagataatggttttgatgcgaaagagcttcgtcctaa |
24694752 |
T |
|
| Q |
108 |
tgcatgatacttgttggtgggtttggtaacaaaccctggccctctccattggacccatcctctaagatatattcctctctc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24694751 |
tgcatgatacttgttggtgggtttggtaacaaaccctggccctctccattggacccatcctctaagatatattcctctctc |
24694671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 83 - 167
Target Start/End: Complemental strand, 17189375 - 17189290
Alignment:
| Q |
83 |
ttgatgcgaaagagcttcgtcctaat-gcatgatacttgttggtgggtttggtaacaaaccctggccctctccattggacccatcc |
167 |
Q |
| |
|
|||||||||||| |||||||||||| ||| |||| ||||||| |||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
17189375 |
ttgatgcgaaaggccttcgtcctaatcgcacgataggtgttggtaggttaggtaacaaaccctgcccctcctcattggacccatcc |
17189290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University