View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076-Insertion-12 (Length: 228)
Name: NF5076-Insertion-12
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076-Insertion-12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 228
Target Start/End: Complemental strand, 20093944 - 20093725
Alignment:
| Q |
8 |
actacttggcataagtgtgatataaataattcttacgtttaccataagcaaggttgaatgttgattcataatgaggaagctagaacatgccccacgagca |
107 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20093944 |
actacttggcataattgtgatataaataattcttacgtttaccataagcaaggttcaatgttgattcataatgaggaagctagaacatgccccacgagca |
20093845 |
T |
 |
| Q |
108 |
aagcaaattaattaactttacggggtccatgatccaaacattatgccctcatacaatacaattgtactacaatctcatcaactagtgaaagtaacgatgc |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
20093844 |
aagcaaattaattaactttacagggtccatgatccaaacaacatgccctcatacaatacaattgtactac-atctcatcaactagtgaaagtaatgatgt |
20093746 |
T |
 |
| Q |
208 |
ccctccttgtgcgctggctgt |
228 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
20093745 |
ccctccttgtgcgctggctgt |
20093725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University