View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076_high_37 (Length: 264)
Name: NF5076_high_37
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076_high_37 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 47 - 264
Target Start/End: Original strand, 10342654 - 10342871
Alignment:
| Q |
47 |
cttcatcattggctttactttacacctcccctgtatgactctacacctccccactttaccccatgtcatcccaaagtttgaagtttcatcagcttccctc |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10342654 |
cttcatcattggctttactttacacctcccccgtataactctacacctccccacattaccccatgtcatcccaaagtttgaagtttcatcagcttccctc |
10342753 |
T |
 |
| Q |
147 |
tactctctcaatataaacagctctagaatatctgctgaatgggatgttaccctcaacgttttaaaccctaaatattggctcgacgtctcttacaaagtcg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10342754 |
tactctctcaatataaacagctctagaatatctgctgaatgggatgttaccctcaacgttttaaaccctaaatattggctcgacgtctcttacaaagtcg |
10342853 |
T |
 |
| Q |
247 |
tttccgttggtgttcatt |
264 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
10342854 |
tttccgtaggtgttcatt |
10342871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 49
Target Start/End: Original strand, 10342588 - 10342627
Alignment:
| Q |
10 |
aagaatatccagacggacaacgaagtgtatccactggctt |
49 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10342588 |
aagaatatccagacggacaatgaagtgtatccactggctt |
10342627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University