View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076_high_47 (Length: 249)
Name: NF5076_high_47
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076_high_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 95 - 212
Target Start/End: Original strand, 33206349 - 33206466
Alignment:
| Q |
95 |
gaaagtacacaaggttatcgacaaggtgccaccctctactttcaacctcaacagaacattgctccagtacggccaaccttcttggtcaattcggatcaat |
194 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
33206349 |
gaaagtacacaaggttatcaacaaggtgccaccctctactttcaacctcaacggaacattgctccggtacggccaaccttctttgtcaattcggatcaat |
33206448 |
T |
 |
| Q |
195 |
tgatgaggtggtcattta |
212 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33206449 |
tgatgaggtggtcattta |
33206466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University