View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076_high_51 (Length: 244)
Name: NF5076_high_51
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076_high_51 |
 | |
|
| [»] scaffold0257 (1 HSPs) |
| | |
|
| [»] scaffold0043 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0257 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0257
Description:
Target: scaffold0257; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 20094 - 20325
Alignment:
| Q |
1 |
catttatatatcaaccagaaccttacaattgcagtctagcaaagcaatgccttcattttgtttgcatttaattgtagtaatctcttagcnnnnnnngttg |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20094 |
catttatatatcaaccaaaaccttacaattgcagtctagcaaagcaatgccttcattttgtttgcatttaattgtagtaatctcttagcaaaaaaagttg |
20193 |
T |
|
| Q |
101 |
ggtcagaatgcttcgattcgatcagatactatttagaaacaccgttattgtcactatccagtttggatttttctcaaacgaacagaggaaactaatgagt |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20194 |
ggtcagaatgctttgattcgatcagatactatttagaaacaccgttattgtcactatccagtttggatttttctcaaacgaacagaggaaactaatgagt |
20293 |
T |
|
| Q |
201 |
tcacaaggtaaaattgaaaaacagtaaatatt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20294 |
tcacaaggtaaaattgaaaaacagtaaatatt |
20325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 49414 - 49366
Alignment:
| Q |
38 |
agcaaagcaatgccttcattttgtttgcatttaattgtagtaatctctt |
86 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| ||||||| |||| |||| |
|
|
| T |
49414 |
agcaaagcaaggccttcattttgtatgcattgaattgtactaatatctt |
49366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University