View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076_high_52 (Length: 243)
Name: NF5076_high_52
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076_high_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 87 - 225
Target Start/End: Original strand, 2635759 - 2635897
Alignment:
| Q |
87 |
gattcagtgtctttatcccaaagccattacttccattacctgccactggccattgccagcaatttttcattattcatattttgttagaatttgctaattt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2635759 |
gattcagtgtctttatcccaaagccattacttccattacctgccactggccattgccagcaatttttcattattcatatttagttagaatttgctaattt |
2635858 |
T |
 |
| Q |
187 |
gtttatagttgatttgtcaatgccctagtagtgacccat |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2635859 |
gtttatagttgatttgtcaatgccctagtagtgacccat |
2635897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 2635685 - 2635745
Alignment:
| Q |
1 |
ttacgtttggaagggaaaagaaagcacttggtactgtgtatcagaatattctatatacctc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2635685 |
ttacgtttggaagggaaaagaaagcacttggtactgtgtatcagaatattctatatacctc |
2635745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University