View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076_high_65 (Length: 212)
Name: NF5076_high_65
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076_high_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 16 - 108
Target Start/End: Complemental strand, 35406277 - 35406185
Alignment:
| Q |
16 |
aatatccatatctttcaatgcaaggaaagaaagacaagaataagctagaaaaatgtgattttcatgtgcattaccatgctaaaacaccaacac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35406277 |
aatatccatatctttcaatgcaaggaaagaaagacaagaataaactagaaaaatgtgattttcatgtgcattaccatgctaaaacaccaacac |
35406185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 141 - 195
Target Start/End: Complemental strand, 35406152 - 35406098
Alignment:
| Q |
141 |
tgacttgttccaaggcttctgtggtaatagtattaatgataaagaagggaaaggt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35406152 |
tgacttgttccaaggcttctgtggtaatagtattaatgataaagaagggaaaggt |
35406098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University