View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076_low_38 (Length: 265)
Name: NF5076_low_38
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 14513455 - 14513217
Alignment:
| Q |
18 |
ctcacatacaccacaatcaccaatttctcttcacaaacctcccaatttccttaacaacccaccacttttcttcaccatctcctcttcataaatttcatca |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14513455 |
ctcacttacaccacaatcaccaatttctcttcacaaacctcccaatttccttaacaacccaccacttttcttcaccatctcctcttcataaatttcatca |
14513356 |
T |
|
| Q |
118 |
taattctcactctatttatgccattaatccttctcaagaagtatttttaccgttgctaaataaattaaccactgcaaaagtggaattaagccctattttt |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14513355 |
taattctcacactatttatgccattaatccttctcaagaagtatttttaccgttgctaaataaattaatcactgcaaaagtggaattaagccctattttt |
14513256 |
T |
|
| Q |
218 |
gatgctatagatgactcttcttcaaaccaagtaactatc |
256 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14513255 |
gatgctatagatgagtcttcttcaaaccaagtaactatc |
14513217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University