View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076_low_48 (Length: 250)
Name: NF5076_low_48
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 10342909 - 10343109
Alignment:
| Q |
1 |
tcttcttgattctttctcccatggaagcaatgacaacgtaaccctcggagtccaattcaacatgaccgtacatgtggatgataaggtagcaactgacatt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10342909 |
tcttcttgattctttcttccatggaagcaatgacaacgtaaccctcggtgtccgattcaacatgaccgtacatgtggatgataaggtagcaactgacatt |
10343008 |
T |
 |
| Q |
101 |
gttgttagtcgttctcgtggaagagttaagtttgggattgtgttatcccttctggtcaactatagtgatatgttttatttctatcgtggtcgtcctttga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10343009 |
gttgttagtcgttctcgtggaagagttaagtttgggattttgttatcccttctggtcaactatagtgatatgttttatttctatcgaggtcgtcctttga |
10343108 |
T |
 |
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
10343109 |
a |
10343109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University