View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076_low_51 (Length: 248)
Name: NF5076_low_51
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076_low_51 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 15569586 - 15569824
Alignment:
| Q |
10 |
gcagagaagactacatgagcagcttgaggtaaacacacaaactttacaaaagctctacaaaatctttttataagtgcacatatatttggaatcttggcga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15569586 |
gcagagaagactacatgagcagcttgaggtaaacacacaaactttacaaaagctctacaaaatctttttataagtgcacatatatttggaatcttggcga |
15569685 |
T |
|
| Q |
110 |
gtttgacgaaattataacgatcgcaccgtgattttgttgaaccttctaagttctaagtgcatatttttccaaagttaaacctagatcctttgcaaccagt |
209 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15569686 |
gtttgacgaaattataacggtggcaccgtgattttgttgaaccttctaagttctaagtgcatatttttccaaaattaaacctagatcctttgcaaccagt |
15569785 |
T |
|
| Q |
210 |
tctatggtgcaatcaattgtatatacagtgcatccggct |
248 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15569786 |
tgtatggtgcaatcaattgtatatacagtgcatccggct |
15569824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University