View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076_low_60 (Length: 236)
Name: NF5076_low_60
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 43 - 221
Target Start/End: Complemental strand, 34130029 - 34129856
Alignment:
| Q |
43 |
ttggaaggaacgaacaatttccactccactctgttcatgatgttgaagtgatgcaaattgtaattgacacgtatgcataatttaacgattagcgatacca |
142 |
Q |
| |
|
||||||||||| |||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34130029 |
ttggaaggaacaaacaatttgcaccccactgtgttcatgatgttgaagtgatgcaaattgtaattgacacgtatgcataatttaacgatttgcgatacca |
34129930 |
T |
 |
| Q |
143 |
gccgtccaaaatcatactctggagctttcatcgaaatactttttgttggggtgctgaatcagaaaccactgaactaagt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
34129929 |
gccgtccaaaatcatactctggagctttcatccaaagacttttt-----ggtgctgaatcagaaaccaatgaactaagt |
34129856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 28 - 100
Target Start/End: Complemental strand, 34130347 - 34130275
Alignment:
| Q |
28 |
cgtcaagactttatattggaaggaacgaacaatttccactccactctgttcatgatgttgaagtgatgcaaat |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34130347 |
cgtcaagactttatatttgaaggaacgaacaatttccactccactctgttcatgatgttgaagtgaggcaaat |
34130275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 79
Target Start/End: Complemental strand, 34125315 - 34125279
Alignment:
| Q |
43 |
ttggaaggaacgaacaatttccactccactctgttca |
79 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34125315 |
ttggaaggaacgaacaatttcaactccactctgttca |
34125279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 34130419 - 34130390
Alignment:
| Q |
1 |
tgattagattattgtccatagctattacgt |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34130419 |
tgattagattattgtccatagctattacgt |
34130390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University