View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076_low_63 (Length: 228)
Name: NF5076_low_63
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076_low_63 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 15570242 - 15570021
Alignment:
| Q |
7 |
gttaggccttttcttgccaagacataaattctcattgatttgcataaatccatgatgatctagggtttgcttgtccatgttttgttgaaggtcaagttga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15570242 |
gttaggccttttcttgccaagacataaattctcattgatttgcataaatccatgatgatctagggtttgcttgtccatgttttgttgaaggtcaagttga |
15570143 |
T |
 |
| Q |
107 |
tcaccaccaccaccgccgcctccgaaaaggtcgagatcttgaaaagatgaaaaactaagaggtgaaccaaattctttcaatagtcccatttcagccattc |
206 |
Q |
| |
|
|||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15570142 |
tcaccaccgccgccgccgcctccgaataggtcgagatcttgaaaagatgaaaaactaagaggtgaaccaaattctttcaatagtcccatttcagccattc |
15570043 |
T |
 |
| Q |
207 |
catgaggtcctacaacaacacc |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
15570042 |
catgaggtcctacaacaacacc |
15570021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University