View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5076_low_66 (Length: 217)

Name: NF5076_low_66
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5076_low_66
NF5076_low_66
[»] chr2 (1 HSPs)
chr2 (18-201)||(171809-171992)


Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 171809 - 171992
Alignment:
18 atgaatttgaaagaggaagctgctctttctggccctgatcgtgttttcacatcaagaaaaattgaattgagaaaacaaaattcttattggcacggtagta 117  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
171809 atgaatttgaaagaggaagctgctcttcctggccctgatcgtgttttcacatcaagaaaaattgaattgagaaaacaaaattcttattggcacggtagta 171908  T
118 ctgcacaattgtcaagattttctaattcagttgcaattcgaggtgattcacgaattgatatgagtggagactgtagtttgaact 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||    
171909 ctgcacaattgtcaagattttctaattcagttgcaattcgaggtgattcacaacttgatatgagtggagactgtagtttgaact 171992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University