View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5076_low_68 (Length: 209)
Name: NF5076_low_68
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5076_low_68 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 42638490 - 42638282
Alignment:
| Q |
1 |
ggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatcaccacactttttcgtataataaaaagtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42638490 |
ggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatcaccacactttttcgtatcataaaaagtta |
42638391 |
T |
|
| Q |
101 |
tgatatggcagagtacttgaaactggaattcatgaaggtaaatgaatatctggttgccaaatttgcattagtgttttgacgaaagtatgggactgacaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42638390 |
tgatatggcagagtacttgaaactggaattcatgaaggtaaatgaatatctggttgccaaatttgcattagtgttttgacgaaagtatgggactcacaag |
42638291 |
T |
|
| Q |
201 |
actttcttc |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
42638290 |
actttcttc |
42638282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 42566462 - 42566545
Alignment:
| Q |
1 |
ggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatcaccacactttttc |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42566462 |
ggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatcaccacaatttttc |
42566545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University