View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5076_low_68 (Length: 209)

Name: NF5076_low_68
Description: NF5076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5076_low_68
NF5076_low_68
[»] chr4 (2 HSPs)
chr4 (1-209)||(42638282-42638490)
chr4 (1-84)||(42566462-42566545)


Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 42638490 - 42638282
Alignment:
1 ggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatcaccacactttttcgtataataaaaagtta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
42638490 ggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatcaccacactttttcgtatcataaaaagtta 42638391  T
101 tgatatggcagagtacttgaaactggaattcatgaaggtaaatgaatatctggttgccaaatttgcattagtgttttgacgaaagtatgggactgacaag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
42638390 tgatatggcagagtacttgaaactggaattcatgaaggtaaatgaatatctggttgccaaatttgcattagtgttttgacgaaagtatgggactcacaag 42638291  T
201 actttcttc 209  Q
    |||||||||    
42638290 actttcttc 42638282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 42566462 - 42566545
Alignment:
1 ggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatcaccacactttttc 84  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
42566462 ggaatttcgatgaggcttgttctgggctcaagcaattgtatgacttgggatattcccccacagatatcatcaccacaatttttc 42566545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University