View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5077-Insertion-1 (Length: 1200)
Name: NF5077-Insertion-1
Description: NF5077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5077-Insertion-1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 7e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 7e-77
Query Start/End: Original strand, 48 - 232
Target Start/End: Complemental strand, 41368345 - 41368161
Alignment:
| Q |
48 |
aagattatctcatctaaccgcacactcaatccatcttgcaccgttagattatggatgaaagagatggctttgaataaagtgtacgtagatttagtgagga |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41368345 |
aagattatctcatctaaccgcacactcaatccatcttgcaccgttagattatggatgaaagagatggctttgaataaagtgtacgtagatttagtgagga |
41368246 |
T |
|
| Q |
148 |
aacggtgatctgaataagaatggctgagtttgg-ccacgtcggaccaattaatgg-tagcgaatacatatgaaagttgtactttaga |
232 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
41368245 |
aacgg-gatttgaataagaatggctgagtttggaccacgtcggaccaattaatggttagc-aatacatatgaaaattgtactttaga |
41368161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 669 - 743
Target Start/End: Complemental strand, 2378638 - 2378564
Alignment:
| Q |
669 |
gagccgttgtagggcatacgtgtggttcgacgattacagattcgtgcgaatcgtaatcgtcgagagagattcgtg |
743 |
Q |
| |
|
||||||||||| |||||||||| || |||||| |||| |||||||| |||| |||| |||||| |||||||||| |
|
|
| T |
2378638 |
gagccgttgtaaggcatacgtgaggctcgacggttacggattcgtgggaattgtaaccgtcgaatgagattcgtg |
2378564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 667 - 732
Target Start/End: Complemental strand, 16713016 - 16712950
Alignment:
| Q |
667 |
aagagccgttgtagggcatacgtgtgg-ttcgacgattacagattcgtgcgaatcgtaatcgtcgag |
732 |
Q |
| |
|
||||||| ||||||||||||||| || ||||||| ||||| ||||||| ||||||||| ||||||| |
|
|
| T |
16713016 |
aagagccattgtagggcatacgtaaggcttcgacggttacatattcgtgggaatcgtaaccgtcgag |
16712950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University